Исследуете COVID-19? Предлагаем материалы для исследования SARS-CoV-2 и разработки вакцин от компании Мерк. Часть 1.

Предлагаем все необходимое в работе с COVID-19 для обнаружения, характеризации вируса и разработки лекарственных средств.

Наш приоритет в условиях пандемии SARS-CoV-2– обеспечение своевременного снабжения и экспертная поддержка исследовательских лабораторий.

Мы предлагаем моноклональные антитела и продукты для:

  • очистки вирусной РНК
  • проведения ОТ-ПЦР
  • количественной ОТ-ПЦР
  • иммунологического анализа
  • вспомогательных реагентов для разработки аналитических методик диагностики SARS-CoV-2.

Наборы и реагенты для количественного ПЦР-определения коронавируса 2019-nCoV

Наборы для количественного ПЦР-определения коронавируса 2019-nCoV (SARS-CoV-2) представлены в линейке KiCqStart®.

  • обнаружение с помощью SYBR® Green – праймеры KiCqStart
  • обнаружение с помощью зондов – анализы KiCqStart с использованием зондов

Ниже приведён перечень доступных целевых структур для обнаружения:

    
Детектирующая структураПрямая последовательностьОбратная последовательностьЗонд
SYBR Green 1GCCTCTTCTCGTTCCTCATCACAGCAGCATCACCGCCATTG
SYBR Green 2AGCCTCTTCTCGTTCCTCATCACCCGCCATTGCCAGCCATTC
Двояко-меченый зонд 1 CCGCAAGGTTCTTCTTCGTAAGTGCTATGTTTAGTGTTCCAGTTTTCAAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 2GGCTTACCGCAAGGTTCTTCTGCTATGTTTAGTGTTCCAGTTTTCAAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 3CAGGTATATGCGCTAGTTATCAGACCCAAGTGACATAGTGTAGGCAATGAGACTAATTCTCCTCGGCGGGCACG
Двояко-меченый зонд 4GCAGGTATATGCGCTAGTTATCAGACACTGGTAGAATTTCTGTGGTAACAGACTAATTCTCCTCGGCGGGCACG

 

ОТ-ПЦР и количественная ОТ-ПЦР: молекулярный анализ и вспомогательные реагенты

Компания ProSpection s.r.o. предлагает реагенты, наборы и инструменты для определения SARS-CoV-2 методом ПЦР стандартной и расширенной функциональности для достоверности, производительности и точности анализа:

  • Набор Transcriptor One-Step RT-PCR содержит Taq ДНК-полимеразу и корректирующую полимеразу, обеспечивающие высокую чувствительность и надёжность результатов обратной транскрипции. Набор содержит все необходимые компоненты (кроме матриц и праймеров) для проведения одностадийной ОТ-ПЦР.
  • Набор KAPA PROBE FAST One-Step для быстрого, высокоэффективного одностадийного количественного определения РНК. Набор используется в сочетании с любыми флуорогенными зондами, включая гибридизационные зонды (например, FRET), гидролизуемые зонды (например, TaqMan®) и зонды-молекулярные маяки.
  • Система Titan™ One Tube RT-PCR – синтез первой цепочки ДНК осуществляется с помощью обратной транскриптазы вируса миелобластоза птиц (AMV), а последующая амплификация кДНК – с помощью смеси ферментов Expand™ High Fidelity, в состав которой входят ДНК-полимераза Taq и корректирующая полимераза.
  • Комплект Quantitative RT-PCR ReadyMix™ помимо обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT), набор содержит также растворы ДНК-полимеразы JumpStart Taq DNA, дезоксинуклеотиды 99% чистоты, а также буферные растворы и стабилизаторы, поставляемые в виде растворов двойной концентрации.
  • Комплект KiCqStart® One-Step Probe RT-qPCR ReadyMix™ для работы со всеми типами двояко-меченых зондов и содержит все необходимые реагенты (кроме РНК и зондов). Возможна поставка комплекта KiCqStart® One-Step Probe RTqPCR ReadyMix™ с референсным красителем ROX™ или без него.
  • Комплект SYBR® Green Quantitative RT-qPCR сочетет в себе преимущества обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT) и ДНК-полимеразы JumpStart Taq DNA, входящих в состав удобной в работе смеси ReadyMix, позволяет проводить высокочувствительный количественный анализ экспрессии генов.

 

Описание№ в каталоге
Transcriptor One-Step RT-PCR KitTOSRTRO
KAPA PROBE FAST One-StepKK4752
Titan™ One Tube RT-PCR System11855476001
Quantitative RT-PCR ReadyMix™QR0200
KiCqStart® One-Step Probe RT-qPCR ReadyMix™KCQS07
KiCqStart® One-Step Probe RT-qPCR ReadyMix™, Low ROX™KCQS08
KiCqStart® One-Step Probe RT-qPCR ReadyMix™, ROX™KCQS09
Nuclease-Free Water, Molecular GradeW4502
SYBR® Green Quantitative RT-qPCRQR0100
NucleoClean™ Decontamination Spray (alternative to bleach)3097S
ViralXress DNA/RNA Extraction Reagent3095
Nuclease Free Water3098

 

Продукты предназначены только для исследовательских целей. Не использовать для диагностики.

Сверхчистая вода

Предлагаем систему получения сверхчистой воды Milli-Q® IQ 7000 для получения воды I типа, до 250 л/день из воды II, III типа или дистиллированной воды.

  • Система комплектуется различными финишными фильтрами, она универсальна и удобна в размещении даже в небольшом пространстве
  • Графический интерфейс Q-POD® обеспечивает возможность управления через смартфона или планшет
  • Мелкий размер гранул IQnano® в картриджах IPAK Meta® и IPAK Quanta® существенно повышает кинетические характеристики смолы
  • Это позволяет значительно снизить необходимое количество ионообменного материала: на 33% меньше, чем в картриджах предыдущего поколения Milli-Q® — при этом достигается удаление ионов до остаточного следового уровня
  • Система компактна, ее можно установить на столе или повесить на стену

Параметры воды на выходе системы:

ПараметрЗначение
Удельное сопротивление при 25°С18,2 МОм×см
TOC (общий органический углерод)<2 ppb (мкг/л)
Микроорганизмы<0,01 КОЕ/мл*;< 0,005 КОЕ/мл***
Пирогены (бактериальные эндотоксины):<0,001 ед. энд./мл**
РНК-азы<1 пг/мл**
ДНК-азы5 пг/мл**
Частицы диаметром >0,22 мкм<1 частицы/мл*.

* — при использовании фильтра финишной очистки Millipak® и Millipak® Gold

** — при использовании фильтра финишной очистки BioPak®

*** — при использовании фильтра финишной очистки Millipak®

 

Основные продукты для разработки методик молекулярной диагностики и иммунологического анализа

Антитела для разработки методик серологического анализа используются для классификации человеческих иммуноглобулинов (IgG, IgM, IgA), в цельной крови для разработки методик серологического анализа.

Пробумин – бычий сывороточный альбумин диагностического класса, применяемый в протеазочувствительном иммунологическом анализе и в качестве стабилизирующего агента для реагентов белковой природы, требующих низкого содержания IgG, также применяемый в молекулярной биологии.

ProClin™ 300 – биоцид, эффективная и безопасная для окружающей среды альтернатива для существующих консервантов, применяемых в реагентах для диагностики. При введении в рекомендованных количествах препарат ProClin™ не представляет угрозы здоровью, не токсичен и не требует специальных мер по утилизации.

У нас Вы можете приобрести решения для выделения и очистки молекулы

  • широкий выбор технологий фильтрации
  • буферные растворы
  • растворы для CIP очистки
  • фильтрационное оборудования из нержавеющей стали и емкости Single-Use с одноразовыми стерильными пластиковыми мешками

Мы предлагаем химические реагенты, вспомогательные вещества и липиды, разработанные для производства вакцин. Инновационная система доставки лекарственных средств – полимеры, сквален и кастомизированные липидные соединения упрощает технологические процессы.

 

Описание№ в каталогеСтадия процесса
Millistak+ Pod Depth Filter, CE50 media series, 0.027 m2 surface area, 1/4 in. Hose Barb connectionMCE50027H1Выделение/очистка: фильтры
Millistak+ Depth Filter in µPod format, CE50 media series, 23 cm2 surface area, Luer fitting connectionMCE5023CL3Выделение/очистка: фильтры
Optiscale Capsule Polysep II 1.0/0.5 µm 1/4 in. HB/HBSGW6A47HH3Выделение/очистка: фильтры
Millistak+ Depth Filter in µPod format, D0HC media series, 23 cm2 surface area, Luer fitting connectionMD0HC23CL3Выделение/очистка: фильтры
Millistak+ HC Pod Depth Filter, D0HC media series, 0.027 m2 surface area, 1/4 in. Hose Barb connectionMD0HC027H1Выделение/очистка: фильтры
Pellicon XL Filter Module Durapore 0.45 µm 50c m2PXHVMPC50Выделение/очистка: фильтры
Polysep™ II 1.0/0.2/0.1 µmSGW1A47HH3Выделение/очистка: фильтры
Milligard® 0.2 µmSW03A47HH3Выделение/очистка: фильтры
Milligard® PES 1.2/0.2 µm nominalSMP2A25NB6Выделение/очистка: фильтры
Triton™ X-1001.08643.1000Инактивация вирусов: ПАВ
Benzonase® suitable for biopharmaceutical production EMPROVE® bio1.01697Удаление ДНК/РНК: Обработка нуклеазой
Benzonase® suitable for biopharmaceutical production EMPROVE® bio1.01695Удаление ДНК/РНК: Обработка нуклеазой
Benzonase® ELISA kit II for the immunological detection of Benzonase®1.01681Иммуноанализ: ELISA набор
Pellicon XL Ultrafiltration Module Biomax 300 kDa 0.005 m2PXB300C50Ультрафильтрация/диафильтрация
Pellicon® 2 Mini Ultrafiltration Module Biomax-100 C 0.1 m 2P2B100C01Ультрафильтрация/диафильтрация
Pellicon® 2 Mini Ultrafiltration Module Biomax-300 C 0.1 m 2P2B300C01Ультрафильтрация/диафильтрация
MiniChrom Column Eshmuno® Q, 5 ml1.25074.0001Хроматографическая очистка
NatriFlo HD-Q Recon MiniNXF-01Хроматографическая очистка
NatriFlo HD-Q PilotNXF-10Хроматографическая очистка
MiniChrom Column Fractogel DEAE (M), 5 ml1.25079.0001Хроматографическая очистка
MiniChrom Column Fractogel TMAE (M), 5 ml1.25069.0001Хроматографическая очистка
Durapore®  0.22 µm membrane in 25 mm Optiscale® devicesSVGLA25NB6Финишная стерилизующая фильтрация
Millipore Express® SHC membrane in 25 mm Optiscale® devicesSHGEA25NB6Финишная стерилизующая фильтрация

 

Контроль качества и мониторинг производственной среды

Продукты для определения микроорганизмов и показателя стерильности обеспечат надежные результаты исследования.

ПродуктВид работ
Milliflex Oasis® Filtration SystemОпределение микробиологической чистоты
Milliflex® Quantum Rapid DetectionОпределение микробиологической чистоты
Steritest™ NEOИспытание на стерильность
Steritest Media and Rinsing FluidsИспытание на стерильность
Steritest™ Symbio PumpsИспытание на стерильность
PyroMAT™ SystemОпределение пирогенности
Active Air Monitoring- MAS-100® Family/RCS® SeriesМониторинг производственной среды
Air Monitoring Media- Contact Plates, HYCON® Agar Strips, M Air T® Cassettes, Settle PlatesМониторинг производственной среды
Passive Air Monitoring- ICR and LI Settle PlatesМониторинг производственной среды
Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR SwabsМониторинг производственной среды
Settle Plates for Active and Passive Air Monitoring ICR LIМониторинг производственной среды
Microbial Air Samplers MAS for Isolators in the Pharmaceutical IndustryМониторинг производственной среды
Microbial Air Samplers for Isolators in the Pharmaceutical IndustryМониторинг производственной среды
Contact Plates for Personnel and Surface Monitoring ICR RTМониторинг производственной среды
Media Fill Testing in the Pharmaceutical IndustryКонтроль асептического розлива
Milli-Q® IQ 7000 Water SystemСверхчистая вода
BioPak® application pakСверхчистая вода

 

Еще больше материалов и лабораторное оборудование Вы найдете в статье „Исследуете Ковид? Мы предлагаем материалы и оборудование для исследования COVID-19 (SARS-CoV-2) от компании Мерк Часть2“.

Задайте ваши вопросы о продуктах для борьбы с SARS-CoV-2 и COVID-19 нашей команде, мы подберем для Вам подходящий вариант.